|
|||||
|
Click here for information on how to order reprints of this article. | ||||
Human Herpesvirus
6 in Patients With Bell’s Palsy
Souha S. Kanj, MD* Zeina A. Kanafani, MD* Issam Khneisser, MS† Raja A. Sawaya, MD* Mouin S. Abdallah, MD* Bassem I. Yamout, MD* Ghassan M. Matar, PhD† *Department
of Internal Medicine, American University of Beirut Med Center, Beirut,
Lebanon †Department
of Microbiology & Immunology, American University of Beirut Med
Center, Beirut, Lebanon KEY WORDS: Human herpesvirus 6, Bell’s palsy, polymerase chain reaction, infectious etiology
Many studies have attempted to identify an infectious etiology for idiopathic facial palsy (Bell’s palsy). Human herpesvirus 6 (HHV-6) has been associated with neurologic diseases and is thought to be a possible causative agent of Bell’s palsy. In this study, we have tested the sera of 16 patients with Bell’s palsy for the presence of HHV-6 DNA. Only 2 specimens yielded positive results by polymerase chain reaction. This data suggests that HHV-6 viremia is rare in Bell’s palsy, making the etiologic role of this virus less likely. Introduction Human herpesvirus 6 (HHV-6) is a lymphotropic virus that was initially thought to be highly prevalent only in immunocompromised patients. As more sensitive assays were developed, however, it was recognized that by the age of 2 years, nearly all humans are infected with the virus. Seroprevalence in the healthy adult population thus exceeds 95%, with no predilection with regard to gender, race, socioeconomic status, or country.1,2 Like all other herpesviruses, HHV-6 can persist in a latent form after primary infection in the oropharynx, bronchial, and salivary gland epithelia, and possibly in human monocytes and macrophages.2,3 Extensive studies have established HHV-6 to be a major cause of exanthem subitum (roseola infantum or sixth disease) in children. The virus has also been implicated in various disease entities such as febrile seizures in infants,4 mononucleosis-like syndrome,5 and chronic fatigue syndrome.6 In the immunocompromised host, specifically in bone marrow transplant recipients, HHV-6 reactivation has been associated with bone marrow suppression.7 A notable feature of HHV-6 is its neurotropic nature. Encephalitis caused by HHV-6 has been well documented.8 More recently, studies have attempted to demonstrate a causal relationship between HHV-6 and multiple sclerosis.9 In addition, HHV-6 antibodies were found to be elevated in patients with idiopathic facial nerve palsy (Bell’s palsy) and sudden deafness.10 Using polymerase chain reaction (PCR) on serum, we propose to investigate the association between Bell’s palsy and reactivation of HHV-6. If the role of HHV-6 in Bell’s palsy can be substantiated, this could have important therapeutic implications. Methods Patient Data Sixteen patients with idiopathic facial nerve palsy presenting to the American University of Beirut Medical Center between January 2001 and April 2003 were prospectively recruited into the study. Subjects were included if they were older than 15 years and presented within 4 days of onset of symptoms. Exclusion criteria included human immunodeficiency virus (HIV) infection, history of solid organ or bone marrow transplantation, fever (defined as an oral temperature ³38˚C), and symptoms of more than 4 days’ duration. DNA Extraction and Polymerase Blood was collected in edetic acid tubes on presentation. Peripheral mononuclear cells were separated by centrifugation in Vacutainer CPT tubes (Becton-Dickinson, USA). Total DNA was extracted using a lysis buffer containing Triton X-100 detergent (0.5%) with proteinase K enzyme (2.5 mg/mL) and then purified using the phenol chloroform method. PCR using 2 specific primers (primer 1: 5’GATCCGACGCCTACAAACAC3’; primer 2: 5’CGGTGTCACACAGCATAAACTTC3’)11 that flank a highly conserved region in the HHV-6 genome (pHC5 insert)11 was performed. The following PCR conditions were used: pre-denaturation step at 95˚C for 3 minutes, 35 cycles of denaturation at 94˚C for 2 minutes, annealing at 55˚C for 2 minutes, and extension at 72˚C for 2 minutes, followed by a final extension step at 72˚C for 10 minutes. Amplicons of the order of 830 base pairs were detected on agarose gels stained with ethidium bromide and visualized on an ultraviolet transilluminator. Gels were photographed with type 667 Polaroid film. Quality control was ensured through the use of positive and negative controls. The positive control, consisting of the HHV-6 genome insert (H37RV genomic DNA), was provided by the Centers for Disease Control and Prevention (CDC). Negative controls consisted of water blank and DNA extracted from blood of healthy individuals. Results Sixteen patients with Bell’s palsy were included in the study. The mean age was 47 years (range, 17-80 years). The male to female ratio was 0.8:1. The mean time between onset of symptoms and presentation was 1.6 days. Blood samples were collected and tested for the presence of HHV-6 DNA. Only 2 specimens yielded positive results by PCR. Figure 1A shows PCR amplicons of the positive control and of 2 patients with Bell’s palsy. Figure 1B shows the positive control and negative PCR results in 1 healthy individual and 8 representative samples from patients with Bell’s palsy. Discussion Researchers have long sought to identify an infectious etiology for Bell’s palsy. Varicella zoster virus (VZV),12 cytomegalovirus (CMV),10 and lately Chlamydia pneumoniae13 have all been studied as possible candidates. So far, available evidence supports herpes simplex virus type 1 (HSV-1) as a plausible causative agent.14 In a recently published trial, Pitkäranta et al.13 were able to detect HHV-6 DNA in tear fluid in 35% of patients with Bell’s palsy compared with 5% of healthy control subjects using PCR.15 This has prompted the search for a more solid association between HHV-6 and Bell’s palsy, hence the rationale behind this study. Under the stringent conditions used to perform the PCR, only patients with active viral replication were expected to test positive. With only 2 specimen yielding positive results, we conclude that HHV-6 viremia in Bell’s palsy is rare. The higher rate of detection of HHV-6 DNA in tear fluid reported earlier15 could suggest that HHV-6 is reactivated in epithelial cells without leading to viremia. So far, among the herpesviruses, HSV-1 retains the most likely association with Bell’s palsy. Acknowledgment This study was supported
by a grant from the American University of Beirut A/C 686083. References 1. Yoshikawa T, Suga S, Asano Y, et al: Distribution of antibodies to a causative agent of exanthem subitum (human herpesvirus-6) in healthy individuals. Pediatrics 84:675–677, 1989. 2. Levy JA, Ferro F, Greenspan D, et al: Frequent isolation of HHV-6 from saliva and high seroprevalence of the virus in the population. Lancet 335:1047–1050, 1990. 3. Kondo K, Kondo T, Okuno T, et al: Latent human herpesvirus 6 infection of human monocytes/macrophages. J Gen Virol 72:1401–1408, 1991. 4. Kondo K, Nagafuji H, Hata A, et al: Association of human herpesvirus 6 infection of the central nervous system with recurrence of febrile convulsions. J Infect Dis 167:1197–1200, 1993. 5. Akashi K, Eizuru Y, Sumiyoshi Y, et al: Brief report: severe infectious mononucleosis-like syndrome and primary human herpesvirus 6 infection in an adult. N Engl J Med 329:168–171, 1993. 6. Yalcin S, Kuratsune H, Yamaguchi K, et al: Prevalence of human herpesvirus 6 variants A and B in patients with chronic fatigue syndrome. Microbiol Immunol 38:587–590, 1994. 7. Carrigan
DR, Knox KK: Human herpesvirus 6 (HHV-6) isolation from bone marrow:
HHV-6-associated bone marrow suppression in bone marrow transplant patients.
Blood 84:3307–3310, 1994. 8. McCullers JA, Lakeman FD, Whitley RJ: Human herpesvirus 6 is associated with focal encephalitis. Clin Infect Dis 21:571–576, 1995. 9. Alvarez-Lafuente R, Martin-Estefania C, de Las Heras V, et al: Active human herpesvirus 6 infection in patients with multiple sclerosis. Arch Neurol 59:929–933, 2002. 10. Takasaki T, Higashikawa M, Motoyama S, et al: Serum antibodies to human herpesvirus 7, human herpesvirus 6 and cytomegalovirus in patients with idiopathic facial nerve palsy or sudden deafness. J Laryngol Otol 112:617–621, 1998. 11. Aubin JT, Collandre H, Candotti D, et al: Several groups among human herpesvirus 6 strains can be distinguished by Southern blotting and polymerase chain reaction. J Clin Microbiol 29:367–372, 1991. 12. Morgan M, Moffat M, Ritchie L, et al: Is Bell’s palsy a reactivation of varicella zoster virus? J Infect 30:29–36, 1995. 13. Pitkaranta A, Vaheri A, Penttila T, et al: No evidence of acute Chlamydia pneumoniae infection in patients with Bell’s palsy. Otolaryngol Head Neck Surg 126:415–416, 2002. 14. Baringer JR: Herpes simplex virus and Bell palsy. Ann Intern Med 124:63–65, 1996. 15. Pitkaranta
A, Piiparinen H, Mannonen L, et al: Detection of human herpesvirus 6
and varicella-zoster virus in tear fluid of patients with Bell’s palsy
by PCR. J Clin Microbiol
38:2753–2755, 2000. Figure 1. (A)
Polymerase chain reaction (PCR) amplicons of HHV-6 genomic sequence
from 2 patients with Bell’s palsy. Lane 1: 100 Bp ladder; lane 2: water
blank control; lane 3: positive control PCR amplicon; lanes 4 and 5:
PCR amplicons from 2 patients with Bell’s palsy. (B)
Negative PCR results of HHV-6 genomic sequence from representative patients
with Bell’s palsy. Lane 1: 100 Bp ladder; lane 2: water blank control;
lane 3: positive control PCR amplicon; lane 4: negative PCR result from
one healthy individual; lanes 5–12: negative PCR results from 8 representative
patients with Bell’s palsy. | |||||
©2000-2010. All Rights Reserved. Therapeutic Solutions LLC
|
|||||